Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

H. Vojtková

Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

In: Industrial, medical and environmental applications of microorganisms

Author:

H. Vojtková

H. Vojtková Institute of Environmental Engineering, Faculty of Mining and Geology, VŠB – Technical University of Ostrava, 17. Listopadu 15/2172, 70833 Ostrava, Poruba, Czech Republic; hana.vojtkova@vsb.cz

Search for other papers by H. Vojtková in
Current site
Google Scholar
PubMed

Type:: Chapter

Pages:: 147–152

DOI:: https://doi.org/10.3920/9789086867950_025

Purchase instant access (PDF download and unlimited online access):

€42.00€35.00 excl. VAT

Add to Cart

Redeem Access Token

Bacteria with verified toxic-metal-resistance were isolated from the environments with increased metal concentrations, especially from localities contaminated by mining, industrial or agricultural activities. The microbial diversity of sites with a high proportion of metals is characterized by the occurrence of specifically adapted microorganisms; their identification and subsequent accurate genotypic and phenotypic characteristics are a prerequisite for further practical applications, especially in bioremediation processes. The paper examines and compares physiological properties for tolerance to the presence of toxic metals in bacterial species from a single taxonomic genus of Pseudomonas. It compares 8 newly isolated strains originating from anthropogenic sediments on the locality Ostrava Lagoons (Czech Republic), that is an area with significant pollution. The Ostrava Lagoons are full of crude oil sludge gathered throughout the whole 20^th century in Ostrava. The sludge predominantly comes from the local chemical plant Ostramo, dealing with disposal of waste left from crude oil processing. Despite the fact its operation was terminated in 1996, the Ostrava Lagoons are considered one of the most severe environmental loads in the Czech Republic as approximately 200,000 tons of contaminated slurries had been disposed there. In addition to the high content of organic pollutants, contaminated soils contain also other toxic metal elements (As, Cd, Cu, Hg, Ni, Pb). Isolates which showed the highest metal resistance was chosen for further identification by 16S rDNA sequence analysis. The 16S rDNA from the extracted DNA was amplified by PCR using 27F (5’–AGAGTTTGATCCTGGCTCAG–3’) and 1492R (5’–ACGGCTACCTTGTTACGACTT–3’) primers, for an exact biochemical properties of strains, the method of standard biotypization applying a BiologTM MicroStation system was used. The resistance of the bacterial strains was evaluated on the grounds of maximum tolerance concentration (MTC) representing the top metal concentration which does not demonstrate a physiological effect on the growth of the bacterial strain; higher values represents the metal concentration with a lethal effect on the growth of the bacterial strain. The experimental results corroborate high metal tolerance in the bacterial strains originating from localities rich in heavy metals, among the decisive factors for tolerance there is high bacteria’s adaptation capacity reflected by the extensive species diversity of the Pseudomonas bacterial genus.

Citation Info

Save
Cite
Email this content

Share link with colleague or librarian

You can email a link to this page to a colleague or librarian:
Email this content
or copy the link directly:

https://brill.edhh.ma/abstract/book/9789086867950/BP000025.xml
The link was not copied. Your current browser may not support copying via this button.

Link copied successfully

Collapse
Expand

Industrial, medical and environmental applications of microorganisms

Current status and trends

E-Book ISBN:: 9789086867950

Publisher:: Wageningen Academic

Print Publication Date:: 01 Nov 2014

Subjects
- Life Sciences

Metrics

	All Time	Past 365 days	Past 30 Days
Abstract Views	212	79	18
Full Text Views	6	2	0
PDF Views & Downloads	1	0	0

African Studies	Education	Media Studies
American Studies	History	Middle East and Islamic Studies
Ancient Near East and Egypt	Human Rights and Humanitarian Law	Musicology
Art History	International Law	Philosophy
Asian Studies	International Relations	Religious Studies
Biblical Studies	Jewish Studies	Slavic and Eurasian Studies
Biology	Languages and Linguistics	Social Sciences
Book History and Cartography	Life Sciences	Theology and World Christianity
Classical Studies	Literature and Cultural Studies

Subjects

Authors

Open Access

Product Information

Company

Contact

Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

Citation Info

Share link with colleague or librarian

Industrial, medical and environmental applications of microorganisms

Current status and trends

Table of Contents

Metrics

Metrics