Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

H. Vojtková

Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

in Industrial, medical and environmental applications of microorganisms

Autor:in:

H. Vojtková

H. Vojtková Institute of Environmental Engineering, Faculty of Mining and Geology, VŠB – Technical University of Ostrava, 17. Listopadu 15/2172, 70833 Ostrava, Poruba, Czech Republic; hana.vojtkova@vsb.cz

Search for other papers by H. Vojtková in
Current site
Google Scholar
PubMed

Art:: Kapitel

Seiten:: 147–152

DOI:: https://doi.org/10.3920/9789086867950_025

Über Institut einloggen

Sofortzugang erwerben (PDF-Download und unbegrenzter Online-Zugang):

42,00 €35,00 € excl. VAT

Add to Cart

Token einlösen

Bacteria with verified toxic-metal-resistance were isolated from the environments with increased metal concentrations, especially from localities contaminated by mining, industrial or agricultural activities. The microbial diversity of sites with a high proportion of metals is characterized by the occurrence of specifically adapted microorganisms; their identification and subsequent accurate genotypic and phenotypic characteristics are a prerequisite for further practical applications, especially in bioremediation processes. The paper examines and compares physiological properties for tolerance to the presence of toxic metals in bacterial species from a single taxonomic genus of Pseudomonas. It compares 8 newly isolated strains originating from anthropogenic sediments on the locality Ostrava Lagoons (Czech Republic), that is an area with significant pollution. The Ostrava Lagoons are full of crude oil sludge gathered throughout the whole 20^th century in Ostrava. The sludge predominantly comes from the local chemical plant Ostramo, dealing with disposal of waste left from crude oil processing. Despite the fact its operation was terminated in 1996, the Ostrava Lagoons are considered one of the most severe environmental loads in the Czech Republic as approximately 200,000 tons of contaminated slurries had been disposed there. In addition to the high content of organic pollutants, contaminated soils contain also other toxic metal elements (As, Cd, Cu, Hg, Ni, Pb). Isolates which showed the highest metal resistance was chosen for further identification by 16S rDNA sequence analysis. The 16S rDNA from the extracted DNA was amplified by PCR using 27F (5’–AGAGTTTGATCCTGGCTCAG–3’) and 1492R (5’–ACGGCTACCTTGTTACGACTT–3’) primers, for an exact biochemical properties of strains, the method of standard biotypization applying a BiologTM MicroStation system was used. The resistance of the bacterial strains was evaluated on the grounds of maximum tolerance concentration (MTC) representing the top metal concentration which does not demonstrate a physiological effect on the growth of the bacterial strain; higher values represents the metal concentration with a lethal effect on the growth of the bacterial strain. The experimental results corroborate high metal tolerance in the bacterial strains originating from localities rich in heavy metals, among the decisive factors for tolerance there is high bacteria’s adaptation capacity reflected by the extensive species diversity of the Pseudomonas bacterial genus.

Zitierungsangaben

Save
Cite
Inhalt per Mail versenden

Link teilen

Sie können einen Link zu dieser Seite per E-Mail senden:
Inhalt per Mail versenden
oder den Link direkt kopieren:

https://brill.edhh.ma/abstract/book/9789086867950/BP000025.xml
Der Link wurde nicht kopiert. Ihr aktueller Browser unterstützt das Kopieren über diese Schaltfläche möglicherweise nicht.

Link wurde kopiert

Reduzieren
Erweitern
Nach oben

Industrial, medical and environmental applications of microorganisms

Current status and trends

ISBN:: 9789086867950

Verleger:: Wageningen Academic

Print-Publikationsdatum:: 01 Nov 2014

Fachgebiete
- Biowissenschaften

Kennzahlen

	Insgesamt	Letzte 365 Tage	In den letzten 30 Tagen
Aufrufe von Kurzbeschreibungen	213	44	2
Gesamttextansichten	6	1	0
PDF-Downloads	1	0	0

Afrikanistik	Internationale Beziehungen	Nahost- und Islamwissenschaften
Altorientalistik und Ägyptologie	Internationales Recht	Pädagogik
Amerikanistik	Judaistik	Philosophie
Asienwissenschaften	Klassische Altertumswissenschaft	Religionswissenschaft
Bibelauslegung	Kunstgeschichte	Slawistik und Eurasienkunde
Biologie	Literatur- und Kulturwissenschaften	Sozialwissenschaften
Biowissenschaften	Medienwissenschaft	Sprachen und Linguistik
Buchgeschichte und Kartographie	Menschenrechte und humanitäres Völkerrecht	Theologie und Christentum
Geschichte	Musikwissenschaft

Fachgebiete

Autor:innen

Open Access

Produkt-Informationen

Über uns

Kontakt

Physiological aspects of metal resistance in Pseudomonas bacteria isolated from sediments of Ostrava Lagoons, Czech Republic

Zitierungsangaben

Link teilen

Industrial, medical and environmental applications of microorganisms

Current status and trends

Inhaltsverzeichnis

Kennzahlen

Kennzahlen