Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

S.R. Sebastian; K. Vijayakumar; P. Ramadass

Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

In: Mastitis in dairy production

Authors:

S.R. Sebastian

S.R. Sebastian ¹Department of Animal Husbandry, Kerala, India

Search for other papers by S.R. Sebastian in
Current site
Google Scholar
PubMed

K. Vijayakumar

K. Vijayakumar ²Department of Preventive Medicine, College of Veterinary and Animal Sciences, Thrissur, Kerala, India

Search for other papers by K. Vijayakumar in
Current site
Google Scholar
PubMed

, and

P. Ramadass

P. Ramadass ³Dept. of Animal Biotechnology, Madras Veterinary College, Chennai, India

Search for other papers by P. Ramadass in
Current site
Google Scholar
PubMed

Type:: Chapter

Pages:: 274–277

DOI:: https://doi.org/10.3920/9789086865505_038

Purchase instant access (PDF download and unlimited online access):

€42.00€35.00 excl. VAT

Add to Cart

Redeem Access Token

Bovine mastitis caused by multi drug resistant Staphylococcus aureus with an increase in global prevalence poses potential threat to the dairy industry in developing tropics. Strain mediated drug resistance of S.aureus necessitates accurate and reliable methods of strain identification as a prerequisite for the design of effective chemotherapeutic regimens. S.aureus (63 isolates) obtained after screening 1053 quarters from animals brought to the University veterinary teaching hospital and University livestock farms were subjected to detailed bacteriological analysis and antibiotic sensitivity. DNA from 24 S.aureus isolates were genotyped using a Random amplified polymorphic DNA assay. RAPD protocols for genotyping S aureus strains were standardized using a 21 mer arbitrarily primer 5’AGTAAGTGACTGGGGTGAGCG 3’. DNA bands of molecular weight ranging from 234 bp to 4261 bp were recognized from these bacterial isolates. On the basis of RAPD assay the 24 S.aureus isolates could be grouped in to seven distinct strains designated as A,B,C,D,E,F and G respectively. Fifteen (62 per cent) of the isolated belonged to strain A which had 80 per cent clinical recovery on appropriate antibiotic regimen. The arbitrary primed PCR was found to be more reliable in differentiating S aureus strains from bovine mastitis cases. This protocol, which does not require prior knowledge of genome, appears to be a promising tool to verify the antimicrobial efficacy in determining the chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus.

Citation Info

Save
Cite
Email this content

Share link with colleague or librarian

You can email a link to this page to a colleague or librarian:
Email this content
or copy the link directly:

https://brill.edhh.ma/abstract/book/9789086865505/BP000038.xml
The link was not copied. Your current browser may not support copying via this button.

Link copied successfully

Collapse
Expand

Mastitis in dairy production

Current knowledge and future solutions

E-Book ISBN:: 9789086865505

Publisher:: Wageningen Academic

Print Publication Date:: 24 Oct 2005

Subjects
- Life Sciences

Metrics

	All Time	Past 365 days	Past 30 Days
Abstract Views	89	33	6
Full Text Views	6	0	0
PDF Views & Downloads	3	0	0

African Studies	Education	Media Studies
American Studies	History	Middle East and Islamic Studies
Ancient Near East and Egypt	Human Rights and Humanitarian Law	Musicology
Art History	International Law	Philosophy
Asian Studies	International Relations	Religious Studies
Biblical Studies	Jewish Studies	Slavic and Eurasian Studies
Biology	Languages and Linguistics	Social Sciences
Book History and Cartography	Life Sciences	Theology and World Christianity
Classical Studies	Literature and Cultural Studies

Subjects

Authors

Open Access

Product Information

Company

Contact

Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

Citation Info

Share link with colleague or librarian

Mastitis in dairy production

Current knowledge and future solutions

Table of Contents

Metrics

Metrics