Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

S.R. Sebastian; K. Vijayakumar; P. Ramadass

Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

in Mastitis in dairy production

Autor:innen:

S.R. Sebastian

S.R. Sebastian ¹Department of Animal Husbandry, Kerala, India

Search for other papers by S.R. Sebastian in
Current site
Google Scholar
PubMed

K. Vijayakumar

K. Vijayakumar ²Department of Preventive Medicine, College of Veterinary and Animal Sciences, Thrissur, Kerala, India

Search for other papers by K. Vijayakumar in
Current site
Google Scholar
PubMed

, und

P. Ramadass

P. Ramadass ³Dept. of Animal Biotechnology, Madras Veterinary College, Chennai, India

Search for other papers by P. Ramadass in
Current site
Google Scholar
PubMed

Art:: Kapitel

Seiten:: 274–277

DOI:: https://doi.org/10.3920/9789086865505_038

Über Institut einloggen

Sofortzugang erwerben (PDF-Download und unbegrenzter Online-Zugang):

42,00 €35,00 € excl. VAT

Add to Cart

Token einlösen

Bovine mastitis caused by multi drug resistant Staphylococcus aureus with an increase in global prevalence poses potential threat to the dairy industry in developing tropics. Strain mediated drug resistance of S.aureus necessitates accurate and reliable methods of strain identification as a prerequisite for the design of effective chemotherapeutic regimens. S.aureus (63 isolates) obtained after screening 1053 quarters from animals brought to the University veterinary teaching hospital and University livestock farms were subjected to detailed bacteriological analysis and antibiotic sensitivity. DNA from 24 S.aureus isolates were genotyped using a Random amplified polymorphic DNA assay. RAPD protocols for genotyping S aureus strains were standardized using a 21 mer arbitrarily primer 5’AGTAAGTGACTGGGGTGAGCG 3’. DNA bands of molecular weight ranging from 234 bp to 4261 bp were recognized from these bacterial isolates. On the basis of RAPD assay the 24 S.aureus isolates could be grouped in to seven distinct strains designated as A,B,C,D,E,F and G respectively. Fifteen (62 per cent) of the isolated belonged to strain A which had 80 per cent clinical recovery on appropriate antibiotic regimen. The arbitrary primed PCR was found to be more reliable in differentiating S aureus strains from bovine mastitis cases. This protocol, which does not require prior knowledge of genome, appears to be a promising tool to verify the antimicrobial efficacy in determining the chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus.

Zitierungsangaben

Save
Cite
Inhalt per Mail versenden

Link teilen

Sie können einen Link zu dieser Seite per E-Mail senden:
Inhalt per Mail versenden
oder den Link direkt kopieren:

https://brill.edhh.ma/abstract/book/9789086865505/BP000038.xml
Der Link wurde nicht kopiert. Ihr aktueller Browser unterstützt das Kopieren über diese Schaltfläche möglicherweise nicht.

Link wurde kopiert

Reduzieren
Erweitern
Nach oben

Mastitis in dairy production

Current knowledge and future solutions

ISBN:: 9789086865505

Verleger:: Wageningen Academic

Print-Publikationsdatum:: 24 Oct 2005

Fachgebiete
- Biowissenschaften

Kennzahlen

	Insgesamt	Letzte 365 Tage	In den letzten 30 Tagen
Aufrufe von Kurzbeschreibungen	92	36	7
Gesamttextansichten	6	0	0
PDF-Downloads	3	0	0

Afrikanistik	Internationale Beziehungen	Nahost- und Islamwissenschaften
Altorientalistik und Ägyptologie	Internationales Recht	Pädagogik
Amerikanistik	Judaistik	Philosophie
Asienwissenschaften	Klassische Altertumswissenschaft	Religionswissenschaft
Bibelauslegung	Kunstgeschichte	Slawistik und Eurasienkunde
Biologie	Literatur- und Kulturwissenschaften	Sozialwissenschaften
Biowissenschaften	Medienwissenschaft	Sprachen und Linguistik
Buchgeschichte und Kartographie	Menschenrechte und humanitäres Völkerrecht	Theologie und Christentum
Geschichte	Musikwissenschaft

Fachgebiete

Autor:innen

Open Access

Produkt-Informationen

Über uns

Kontakt

Chemotherapeutic approaches to bovine mastitis caused by Staphylococcus aureus through strain identification using random amplified polymorphic DNA analysis

Zitierungsangaben

Link teilen

Mastitis in dairy production

Current knowledge and future solutions

Inhaltsverzeichnis

Kennzahlen

Kennzahlen